IL18R Beta (IL18RAP) (NM_003853) Human 3' UTR Clone

CAT#: SC205160

3`UTR clone of interleukin 18 receptor accessory protein (IL18RAP) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL18RAP
• Synonyms: ACPL; CD218b; CDw218b; IL-1R-7; IL-1R7; IL-1RAcPL; IL-18R-beta; IL-18RAcP; IL-18Rbeta; IL18RB
• ACCN: NM_003853
• Insert Size: 383
• Sequence Data:
  Insert Sequence

  >SC205160 3'UTR clone of NM_003853
  The sequence shown below is from the reference sequence of NM_003853. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGCCTAAGGAATGGTGAAATGAGCCCTGGAGCCCCCTCCAGTCCAGTCCCTGGGATAGAGATGTTGCT
  GGACAGAACTCACAGCTCTGTGTGTGTGTGTTCAGGCTGATAGGAAATTCAAAGAGTCTCCTGCCAGCAC
  CAAGCAAGCTTGATGGACAATGGAGTGGGATTGAGACTGTGGTTTAGAGCCTTTGATTTCCTGGACTGGA
  CTGACGGCGAGTGAATTCTCTAGACCTTGGGTACTTTCAGTACACAACACCCCTAAGATTTCCCAGTGGT
  CCGAGCAGAATCAGAAAATACAGCTACTTCTGCCTTATGGCTAGGGAACTGTCATGTCTACCATGTATTG
  TACATATGACTTTATGTATACTTGCAATCAAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003853.2
• Summary: The protein encoded by this gene is an accessory subunit of the heterodimeric receptor for interleukin 18 (IL18), a proinflammatory cytokine involved in inducing cell-mediated immunity. This protein enhances the IL18-binding activity of the IL18 receptor and plays a role in signaling by IL18. Mutations in this gene are associated with Crohn's disease and inflammatory bowel disease, and susceptibility to celiac disease and leprosy. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
• Locus ID: 8807