BubR1 (BUB1B) (NM_001211) Human 3' UTR Clone

CAT#: SC205164

3`UTR clone of budding uninhibited by benzimidazoles 1 homolog beta (yeast) (BUB1B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BUB1B
• Synonyms: Bub1A; BUB1beta; BUBR1; hBUBR1; MAD3L; MVA1; SSK1
• ACCN: NM_001211
• Insert Size: 393 bp
• Sequence Data:
  Insert Sequence

  >SC205164 3'UTR clone of NM_001211
  The sequence shown below is from the reference sequence of NM_001211. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGCTTTGCTCTTTCAGTGAGCTAGGCAATCAAGTCTCACAGATTGCTGCCTCAGAGCAATGGTTGTATTG
  TGGAACACTGAAACTGTATGTGCTGTAATTTAATTTAGGACACATTTAGATGCACTACCATTGCTGTTCT
  ACTTTTTGGTACAGGTATATTTTGACGTCACTGATATTTTTTATACAGTGATATACTTACTCATGGCCTT
  GTCTAACTTTTGTGAAGAACTATTTTATTCTAAACAGACTCATTACAAATGGTTACCTTGTTATTTAACC
  CATTTGTCTCTACTTTTCCCTGTACTTTTCCCATTTGTAATTTGTAAAATGTTCTCTTATGATCACCATG
  TATTTTGTAAATAATAAAATAGTATCTGTTAAATTTGTGCTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001211.5
• Summary: 'This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]'
• Locus ID: 701