FGF18 (NM_003862) Human 3' UTR Clone

CAT#: SC205170

3`UTR clone of fibroblast growth factor 18 (FGF18) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FGF18
• Synonyms: FGF-18; ZFGF5
• ACCN: NM_003862
• Insert Size: 395
• Sequence Data:
  Insert Sequence

  >SC205170 3'UTR clone of NM_003862
  The sequence shown below is from the reference sequence of NM_003862. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAGAGGTCCCGTCGGATCCGGCCCACACACCCTGCCTAGGCCACCCCGCCGCGGCCCCTCAGGTCGCCC
  TGGCCACACTCACACTCCCAGAAAACTGCATCAGAGGAATATTTTTACATGAAAAATAAGGAAGAAGCTC
  TATTTTTGTACATTGTGTTTAAAAGAAGACAAAAACTGAACCAAAACTCTTGGGGGGAGGGGTGATAAGG
  ATTTTATTGTTGACTTGAAACCCCCGATGACAAAAGACTCACGCAAAGGGACTGTAGTCAACCCACAGGT
  GCTTGTCTCTCTCTAGGAACAGACAACTCTAAACTCGTCCCCAGAGGAGGACTTGAATGAGGAAACCAAC
  ACTTTGAGAAACCAAAGTCCTTTTTCCCAAAGGTTCTGAAAGGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003862.1
• Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that this protein is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Knockout studies of the similar gene in mice implied the role of this protein in regulating proliferation and differentiation of midline cerebellar structures. [provided by RefSeq, Jul 2008]
• Locus ID: 8817