ITPKA (NM_002220) Human 3' UTR Clone

CAT#: SC205174

3`UTR clone of inositol 145-trisphosphate 3-kinase A (ITPKA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ITPKA
• Synonyms: IP3-3KA; IP3KA
• ACCN: NM_002220
• Insert Size: 400 bp
• Sequence Data:
  Insert Sequence

  >SC205174 3'UTR clone of NM_002220
  The sequence shown below is from the reference sequence of NM_002220. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACAATCTCATTGGCATCCTGGCCAGCCTGGCTGAGAGATGAGGCTGGACTCCTGTCCCCGCGGGCCGC
  TCACCTGACATGTGGACCTGCAGCTTTGTCCCCACTGTGCATGCCGGCTTGAGACTGGAGCCCCGCGGTG
  CAGGGCAGTTCACCGGGTCCTGCAGGACCAGGTGCCAGCCACTAAGGGGGGGCACCGCCGATGCCAGGGG
  TTTTGCCCACCCGGGCCCCAGCGTTCCCAGAGCCAAATGACACTAACTTATAGAAGGGGAGGGGGCAAAG
  GGCTTCTTCCTCAGGCCAGCTCTTCTGAGGAGGCTCTGCCCTCTCCAGAGGTGCCAGACCGCGGATTTTA
  TTTAGCAAGCCCAGACCTTCCGGTCTAACGTCTCACACCACGACGGACTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002220.1
• Summary: 'Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Both calcium/calmodulin and protein phosphorylation mechanisms control its activity. It is also a substrate for the cyclic AMP-dependent protein kinase, calcium/calmodulin- dependent protein kinase II, and protein kinase C in vitro.[provided by RefSeq, Apr 2011]'
• Locus ID: 3706