PRAK (MAPKAPK5) (NM_139078) Human 3' UTR Clone

CAT#: SC205181

3`UTR clone of mitogen-activated protein kinase-activated protein kinase 5 (MAPKAPK5) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAPKAPK5
• Synonyms: MAPKAP-K5; MK-5; MK5; PRAK
• ACCN: NM_139078
• Insert Size: 395
• Sequence Data:
  Insert Sequence

  >SC205181 3'UTR clone of NM_139078
  The sequence shown below is from the reference sequence of NM_139078. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAAGAGCAAACCACGTCCCACGAATCCCAATAATGACAGCTTCAGACTTTGTTTTTTTAACAATTTGAA
  AAATTATTCTTTAATGTATAAAGTAATTTTATGTAAATTAATAAATCATAATTTCATTTCCACATTGATT
  AAAGCTGCTGTATAGATTTAGGGTGCAGGACTTAATAATAGTATAGTTATTGTTTGTTTTTAAGAAAAGC
  TCAGTTCTAGAGACATACTATTACTTTAGGACTGTGTAGTTGTATATTTGTAAGATGACAGATGATGCTG
  TCAAGCAATATTGTTTTATTTGTAATAAAATATACAAAAATCACTTGCCAGCAGTAGAAAAAGGACCGAC
  TATACCGACCTTTCTGATTAGTAAACAGTTGAATCAAGGACTCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_139078.1
• Summary: The protein encoded by this gene is a tumor suppressor and member of the serine/threonine kinase family. In response to cellular stress and proinflammatory cytokines, this kinase is activated through its phosphorylation by MAP kinases including MAPK1/ERK, MAPK14/p38-alpha, and MAPK11/p38-beta. The encoded protein is found in the nucleus but translocates to the cytoplasm upon phosphorylation and activation. This kinase phosphorylates heat shock protein HSP27 at its physiologically relevant sites. Two alternately spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2012]
• Locus ID: 8550