PRAK (MAPKAPK5) (NM_003668) Human 3' UTR Clone

CAT#: SC205182

3`UTR clone of mitogen-activated protein kinase-activated protein kinase 5 (MAPKAPK5) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAPKAPK5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MAPKAPK5
Synonyms MAPKAP-K5; MK-5; MK5; PRAK
ACCN NM_003668
Insert Size 395
Sequence Data
>SC205182 3'UTR clone of NM_003668
The sequence shown below is from the reference sequence of NM_003668. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGAAGAGCAAACCACGTCCCACGAATCCCAATAATGACAGCTTCAGACTTTGTTTTTTTAACAATTTGAA
AAATTATTCTTTAATGTATAAAGTAATTTTATGTAAATTAATAAATCATAATTTCATTTCCACATTGATT
AAAGCTGCTGTATAGATTTAGGGTGCAGGACTTAATAATAGTATAGTTATTGTTTGTTTTTAAGAAAAGC
TCAGTTCTAGAGACATACTATTACTTTAGGACTGTGTAGTTGTATATTTGTAAGATGACAGATGATGCTG
TCAAGCAATATTGTTTTATTTGTAATAAAATATACAAAAATCACTTGCCAGCAGTAGAAAAAGGACCGAC
TATACCGACCTTTCTGATTAGTAAACAGTTGAATCAAGGACTCTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003668.2
Summary The protein encoded by this gene is a tumor suppressor and member of the serine/threonine kinase family. In response to cellular stress and proinflammatory cytokines, this kinase is activated through its phosphorylation by MAP kinases including MAPK1/ERK, MAPK14/p38-alpha, and MAPK11/p38-beta. The encoded protein is found in the nucleus but translocates to the cytoplasm upon phosphorylation and activation. This kinase phosphorylates heat shock protein HSP27 at its physiologically relevant sites. Two alternately spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2012]
Locus ID 8550

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.