VEGFC (NM_005429) Human 3' UTR Clone

CAT#: SC205198

3`UTR clone of vascular endothelial growth factor C (VEGFC) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VEGFC
• Synonyms: Flt4-L; LMPH1D; LMPHM4; VRP
• ACCN: NM_005429
• Insert Size: 415 bp
• Sequence Data:
  Insert Sequence

  >SC205198 3'UTR clone of NM_005429
  The sequence shown below is from the reference sequence of NM_005429. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGTCGTTGTGTCCCTTCATATTGGAAAAGACCACAAATGAGCTAAGATTGTACTGTTTTCCAGTTCATC
  GATTTTCTATTATGGAAAACTGTGTTGCCACAGTAGAACTGTCTGTGAACAGAGAGACCCTTGTGGGTCC
  ATGCTAACAAAGACAAAAGTCTGTCTTTCCTGAACCATGTGGATAACTTTACAGAAATGGACTGGAGCTC
  ATCTGCAAAAGGCCTCTTGTAAAGACTGGTTTTCTGCCAATGACCAAACAGCCAAGATTTTCCTCTTGTG
  ATTTCTTTAAAAGAATGACTATATAATTTATTTCCACTAAAAATATTGTTTCTGCATTCATTTTTATAGC
  AACAACAATTGGTAAAACTCACTGTGATCAATATTTTTATATCATGCAAAATATGTTTAAAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005429.2
• Summary: 'The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. The encoded protein promotes angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. The proprotein is further cleaved into a fully processed form that can bind and activate VEGFR-2 and VEGFR-3 receptors. [provided by RefSeq, Apr 2014]'
• Locus ID: 7424