VEGFC (NM_005429) Human 3' UTR Clone

CAT#: SC205198

3`UTR clone of vascular endothelial growth factor C (VEGFC) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "VEGFC"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol VEGFC
Synonyms Flt4-L; LMPH1D; LMPHM4; VRP
ACCN NM_005429
Insert Size 415 bp
Sequence Data
>SC205198 3'UTR clone of NM_005429
The sequence shown below is from the reference sequence of NM_005429. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGTCGTTGTGTCCCTTCATATTGGAAAAGACCACAAATGAGCTAAGATTGTACTGTTTTCCAGTTCATC
GATTTTCTATTATGGAAAACTGTGTTGCCACAGTAGAACTGTCTGTGAACAGAGAGACCCTTGTGGGTCC
ATGCTAACAAAGACAAAAGTCTGTCTTTCCTGAACCATGTGGATAACTTTACAGAAATGGACTGGAGCTC
ATCTGCAAAAGGCCTCTTGTAAAGACTGGTTTTCTGCCAATGACCAAACAGCCAAGATTTTCCTCTTGTG
ATTTCTTTAAAAGAATGACTATATAATTTATTTCCACTAAAAATATTGTTTCTGCATTCATTTTTATAGC
AACAACAATTGGTAAAACTCACTGTGATCAATATTTTTATATCATGCAAAATATGTTTAAAATAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005429.2
Summary 'The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. The encoded protein promotes angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. The proprotein is further cleaved into a fully processed form that can bind and activate VEGFR-2 and VEGFR-3 receptors. [provided by RefSeq, Apr 2014]'
Locus ID 7424

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.