CYP4Z1 (NM_178134) Human 3' UTR Clone

CAT#: SC205201

3`UTR clone of cytochrome P450 family 4 subfamily Z polypeptide 1 (CYP4Z1) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CYP4Z1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CYP4Z1
Synonyms CYP4A20
ACCN NM_178134
Insert Size 410
Sequence Data
>SC205201 3'UTR clone of NM_178134
The sequence shown below is from the reference sequence of NM_178134. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTCCAAGAATGGAATCCATGTGTTTGCAAAAAAAGTTTGCTAATTTTAAGTCCTTTCGTATAAGAATTAA
TGAGACAATTTTCCTACCAAAGGAAGAACAAAAGGATAAATATAATACAAAATATATGTATATGGTTGTT
TGACAAATTATATAACTTAGGATACTTCTGACTGGTTTTGACATCCATTAACAGTAATTTTAATTTCTTT
GCTGTATCTGGTGAAACCCACAAAAACACCTGAAAAAACTCAAGCTGACTTCCACTGCGAAGGGAAATTA
TTGGTTTGTGTAACTAGTGGTAGAGTGGCTTTCAAGCATAGTTTGATCAAAACTCCACTCAGTATCTGCA
TTACTTTTATCTCTGCAAATATCTGCATGATAGCTTTATTCTCAGTTATCTTTCCCCATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_178134.2
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 1p33. [provided by RefSeq, Jul 2008]
Locus ID 199974

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.