WNT6 (NM_006522) Human 3' UTR Clone

CAT#: SC205211

3`UTR clone of wingless-type MMTV integration site family member 6 (WNT6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: WNT6
• Synonyms: wingless-type MMTV integration site family, member 6
• ACCN: NM_006522
• Insert Size: 379 bp
• Sequence Data:
  Insert Sequence

  >SC205211 3'UTR clone of NM_006522
  The sequence shown below is from the reference sequence of NM_006522. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCAGCCTCTGCCTGTGACCCGCCGCCCGGCCGCTAGACTGACTTCGCGCAGCGGTGGCTCGCACCTGTG
  GGACCTCAGGGCACCGGCACCGGGCGCCTCTCGCCGCTCGAGCCCAGCCTCTCCCTGCCAAAGCCCAACT
  CCCAGGGCTCTGGAAATGGTGAGGCGAGGGGCTTGAGAGGAACGCCCACCCACGAAGGCCCAGGGCGCCA
  GACGGCCCCGAAAAGGCGCTCGGGGAGCGTTTAAAGGACACTGTACAGGCCCTCCCTCCCCTTGGCCTCT
  AGGAGGAAACAGTTTTTTAGACTGGAAAAAAGCCAGTCTAAAGGCCTCTGGATACTGGGCTCCCCAGAAC
  TGCTGGCCACAGGATGGTGGGTGAGGTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006522.3
• Summary: 'The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is overexpressed in cervical cancer cell line and strongly coexpressed with another family member, WNT10A, in colorectal cancer cell line. The gene overexpression may play key roles in carcinogenesis. This gene and the WNT10A gene are clustered in the chromosome 2q35 region. The protein encoded by this gene is 97% identical to the mouse Wnt6 protein at the amino acid level. [provided by RefSeq, Jul 2008]'
• Locus ID: 7475