SNRPB2 (NM_198220) Human 3' UTR Clone

CAT#: SC205213

3`UTR clone of small nuclear ribonucleoprotein polypeptide B'' (SNRPB2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SNRPB2
• Synonyms: Msl1; U2B'
• ACCN: NM_198220
• Insert Size: 408 bp
• Sequence Data:
  Insert Sequence

  >SC205213 3'UTR clone of NM_198220
  The sequence shown below is from the reference sequence of NM_198220. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCACACCGTCCCATGCTATGAAGATCACCTATGCCAAGAAATAACATTTGGGATAGTCGTCTTTAAAAG
  ACTTGGTGTTATTTACAGTGTTTGTTTTGATAACATTTGGCTGGGTCATTTTAATAGTTAGAGATGAGGA
  GGAGTAAAAGTGAAATTTTTGTGAAGGACTTAAATTATCCAGTGTTTCTTTAGCCTTGGTGAACTATGAA
  ATACGAAGGCCTTAATTTTGTACAATAAACTTTTATTTGTATTCTGTGTATATAATGCTTTCTTGATTGA
  CCCATCTCCCTATCATCAAATGACTTCTAGTCTAGAACACACTTAAGGTTTATAAACTTGTGTAATAGGA
  TGCTTTTCTAGTGTTACTTTGGAGGAGCTAATTATACAACATCATTGAACCATTCAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_198220.1
• Summary: 'The protein encoded by this gene associates with stem loop IV of U2 small nuclear ribonucleoprotein (U2 snRNP) in the presence of snRNP-A'. The encoded protein may play a role in pre-mRNA splicing. Autoantibodies from patients with systemic lupus erythematosus frequently recognize epitopes on the encoded protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 6629