ARHGEF1 (NM_198977) Human 3' UTR Clone

CAT#: SC205235

3`UTR clone of Rho guanine nucleotide exchange factor (GEF) 1 (ARHGEF1) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARHGEF1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ARHGEF1
Synonyms GEF1; IMD62; LBCL2; LSC; P115-RHOGEF; SUB1.5
ACCN NM_198977
Insert Size 356
Sequence Data
>SC205235 3'UTR clone of NM_198977
The sequence shown below is from the reference sequence of NM_198977. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGCCTGGCTGCACTTGAGGTTCCCGCCCAGGAAGGCCTTTTGCAAGAAGGAGAGGAATGGGGGAGAGGAC
GTGAGGGACCACCCCCACCCACACAGCTGCCGCAGCATCTCACACCCCGAGGGCCTGAGGAGAGGGAGCT
GTGGGCCACGCCTGGGAGGGGCCCAGCTGGGGTTACTGGCCCCGCATGAGCCTCGGCCATCTCTCCCTCC
TGCCCTCTGCTTGGGGGACTCAGGGCTCCATTCTGGAGGGCACCACGGTGACCCGGGCCATCTCAGTATT
GCCTGTGGGGGCCACCCCTCCACCCCCACCCCCAAGTGCCTTCGCTCTGTTTTTATACCCTGAATTGGAG
GTTTAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198977.1
Summary Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Locus ID 9138

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.