ARHGEF1 (NM_199002) Human 3' UTR Clone

CAT#: SC205237

3`UTR clone of Rho guanine nucleotide exchange factor (GEF) 1 (ARHGEF1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ARHGEF1
• Synonyms: GEF1; IMD62; LBCL2; LSC; P115-RHOGEF; SUB1.5
• ACCN: NM_199002
• Insert Size: 356
• Sequence Data:
  Insert Sequence

  >SC205237 3'UTR clone of NM_199002
  The sequence shown below is from the reference sequence of NM_199002. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCCTGGCTGCACTTGAGGTTCCCGCCCAGGAAGGCCTTTTGCAAGAAGGAGAGGAATGGGGGAGAGGAC
  GTGAGGGACCACCCCCACCCACACAGCTGCCGCAGCATCTCACACCCCGAGGGCCTGAGGAGAGGGAGCT
  GTGGGCCACGCCTGGGAGGGGCCCAGCTGGGGTTACTGGCCCCGCATGAGCCTCGGCCATCTCTCCCTCC
  TGCCCTCTGCTTGGGGGACTCAGGGCTCCATTCTGGAGGGCACCACGGTGACCCGGGCCATCTCAGTATT
  GCCTGTGGGGGCCACCCCTCCACCCCCACCCCCAAGTGCCTTCGCTCTGTTTTTATACCCTGAATTGGAG
  GTTTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_199002.1
• Summary: Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
• Locus ID: 9138