Cathepsin H (CTSH) (NM_004390) Human 3' UTR Clone

CAT#: SC205244

3`UTR clone of cathepsin H (CTSH) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CTSH
• Synonyms: ACC-4; ACC-5; ACC4; ACC5; CPSB
• ACCN: NM_004390
• Insert Size: 374 bp
• Sequence Data:
  Insert Sequence

  >SC205244 3'UTR clone of NM_004390
  The sequence shown below is from the reference sequence of NM_004390. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCATCCCTCTGGTGTGAGCCGTGGCAGCCGCAGCGCAGACTGGCGGAGAAGGAGAGGAACGGGCAGCCT
  GGGCCTGGGTGGAAATCCTGCCCTGGAGGAAGTTGTGGGGAGATCCACTGGGACCCCCAACATTCTGCCC
  TCACCTCTGTGCCCAGCCTGGAAACCTACAGACAAGGAGGAGTTCCACCATGAGCTCACCCGTGTCTATG
  ACGCAAAGATCACCAGCCATGTGCCTTAGTGTCCTTCTTAACAGACTCAAACCACATGGACCACGAATAT
  TCTTTCTGTCCAGAAGGGCTACTTTCCACATATAGAGCTCCAGGGACTGTCTTTTCTGTATTCGCTGTTC
  AATAAACATTGAGTGAGCACCTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004390.3
• Summary: 'The protein encoded by this gene is a lysosomal cysteine proteinase important in the overall degradation of lysosomal proteins. It is composed of a dimer of disulfide-linked heavy and light chains, both produced from a single protein precursor. The encoded protein, which belongs to the peptidase C1 protein family, can act both as an aminopeptidase and as an endopeptidase. Increased expression of this gene has been correlated with malignant progression of prostate tumors. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]'
• Locus ID: 1512