EAP30 (SNF8) (NM_007241) Human 3' UTR Clone

CAT#: SC205256

3`UTR clone of SNF8 ESCRT-II complex subunit homolog (S. cerevisiae) (SNF8) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SNF8"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SNF8
Synonyms Dot3; EAP30; VPS22
ACCN NM_007241
Insert Size 394
Sequence Data
>SC205256 3'UTR clone of NM_007241
The sequence shown below is from the reference sequence of NM_007241. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCAGGAGATTACAGCTGAGGAGGCCAGAGAAGCCCTCCCCTGACTGCATGTGGAAGGGCACACAGCAGCA
GGCAGGGAGGAGGCGGAGGTGGCAAATAAACCTGGGCAATTTTGTTTATACAAAAAATAGAAAAAAAGTT
CCAAGTTTTTCTTTCTTCCCTCATTCTTTTATTTTTGAAAAGTGCCTTCACGTTGCATTTTTATTGGAGG
AAAACCTCGCTCGTTCAGTAAGCATAATCTGATTAACACAGAGAACGGCAAGCACATATAAAATGATTTT
TGTAGGTCATCTGCAAGTTCATGGAAGAGCTGGGCCTAGAATGTGGGTTGTTTCCTGGCCTGTCTAGTCT
TTGTAGCTGTGAGACATAGATTACAGCCTATGCTAATTCAAACC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007241.2
Summary The protein encoded by this gene is a component of the endosomal sorting complex required for transport II (ESCRT-II), which regulates the movement of ubiquitinylated transmembrane proteins to the lysosome for degradation. This complex also interacts with the RNA polymerase II elongation factor (ELL) to overcome the repressive effects of ELL on RNA polymerase II activity. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Locus ID 11267

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.