RFX4 (NM_002920) Human 3' UTR Clone

CAT#: SC205260

3`UTR clone of regulatory factor X 4 (influences HLA class II expression) (RFX4) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RFX4
• Synonyms: NYD-SP10
• ACCN: NM_002920
• Insert Size: 405
• Sequence Data:
  Insert Sequence

  >SC205260 3'UTR clone of NM_002920
  The sequence shown below is from the reference sequence of NM_002920. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCAGCACTACAGGTAATGGAAAGTCCTTCAAAAACTTTGGGTAGTTAATGTTTGAAGAAAGGGCTTTCT
  GCCAGCCTGGGCAACATAGTGAGACTTCATTTCCACACACACAAAAAGCCAGACATCTTGGCTCACACCT
  GTAGTCCCAGCTACTTGGGAGGCTGAGGTGGGAGAATTGCTTGAGCCCAGGAGCTACGATCGCACCACTG
  CATTCTAGCCTTAGTGATACAGTGAGACCTTGTCTCAAAAAAAGAAAAACAGGGCTTTCTGGAAAAACAT
  TCTTCTCCCACAATCTCCAAAAGATAATGCCAAAACCTGGGTATCTTCCTGGATTTGTGAATGACGTACA
  GGTATTCATTTATTCATTGGTACACATTCTGTATGCTGCTGTTTTCAAGTTGGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_002920.3
• Summary: This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
• Locus ID: 5992