BMX (NM_001721) Human 3' UTR Clone

CAT#: SC205263

3`UTR clone of BMX non-receptor tyrosine kinase (BMX) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BMX
• Synonyms: ETK; PSCTK2; PSCTK3
• ACCN: NM_001721
• Insert Size: 426 bp
• Sequence Data:
  Insert Sequence

  >SC205263 3'UTR clone of NM_001721
  The sequence shown below is from the reference sequence of NM_001721. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCCTGTCTTCCATTGAACCACTTCGGGAAAAAGACAAGCATTGAAGAAGAAATTAGGAGTGCTGATAAG
  AATGAATATAGATGCTGGCCAGCATTTTCATTCATTTTAAGGAAAGTAGCAAGGCATAATGTAATTTAGC
  TAGTTTTTAATAGTGTTCTCTGTATTGTCTATTATTTAGAAATGAACAAGGCAGGAAACAAAAGATTCCC
  TTGAAATTTAGATCAAATTAGTAATTTTGTTTATGCTGCTCCTGATATAACACTTTCCAGCCTATAGCAG
  AAGCACATTTTCAGACTGCAATATAGAGACTGTGTTCATGTGTAAAGACTGAGCAGAACTGAAAAATTAC
  TTATTGGATATTCATTCTTTTCTTTATATTGTCATTGTCACAACAATTAAATATACTACCAAGTACAGAA
  ATGTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001721.6
• Summary: 'This gene encodes a non-receptor tyrosine kinase belonging to the Tec kinase family. The protein contains a PH-like domain, which mediates membrane targeting by binding to phosphatidylinositol 3,4,5-triphosphate (PIP3), and a SH2 domain that binds to tyrosine-phosphorylated proteins and functions in signal transduction. The protein is implicated in several signal transduction pathways including the Stat pathway, and regulates differentiation and tumorigenicity of several types of cancer cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]'
• Locus ID: 660