RAC3 (NM_005052) Human 3' UTR Clone

CAT#: SC205268

3`UTR clone of ras-related C3 botulinum toxin substrate 3 (rho family small GTP binding protein Rac3) (RAC3) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAC3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RAC3
Synonyms ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3); rho family, small GTP binding protein Rac3
ACCN NM_005052
Insert Size 392 bp
Sequence Data
>SC205268 3'UTR clone of NM_005052
The sequence shown below is from the reference sequence of NM_005052. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGTGCACCGTCTTCTAGAGCCCTGGCCCACCCGAGCCTGAGGGCTGGCGGGGAGCAGCCCTGGACGTGT
CCGCTGTTGTGTTGAGACGTGTGGTGTCCCTGAGTCGGCTGTGGGGAGCGGTGGGGGTGGGCCGGGGGGA
AGCATGGGGATGAGGCTGGGTGGCAGGATCCTGTCCTCTCTGCCGCCTCATTCTGGGGTGTGGCTCCAGC
CTTCCCTGGCCCCCGCCGGAGGCCGGGAGGGAGCAGGGTCTCCCTCAGGGCTGCAGGGGCAGGTGCAGGG
AAGCCCCAGGATGGGCTTCCCTGGAGGGGGAGGGTGGGGGGGAGTTCTGTTCCTTGTGCCCCGAGGTGGG
GCAGCCCCTTCTCATTTTATACAATAAACATTCTCCACCTAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005052.2
Summary 'The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]'
Locus ID 5881

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.