KCNAB3 (NM_004732) Human 3' UTR Clone

CAT#: SC205281

3`UTR clone of potassium voltage-gated channel shaker-related subfamily beta member 3 (KCNAB3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNAB3
• Synonyms: AKR6A9; KCNA3.1B; KCNA3B; KV-BETA-3
• ACCN: NM_004732
• Insert Size: 413
• Sequence Data:
  Insert Sequence

  >SC205281 3'UTR clone of NM_004732
  The sequence shown below is from the reference sequence of NM_004732. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAACAAGCCGCATTCCAAGAAGTAGTCTGTCGCGGGCGCAGGGACCCAACCCGGTGTCGCTGCACCCGC
  CCGAGCCCCGCTCCTCGCAGCCGCCTCTCCCGCTCCGGATCCCTCCACGCAGCGGCCGGAGCCAGACTAG
  CCCCGCCCACCAACGAGTCCCGGCTTCGAGTAGTGATACGCATGAACAAAGCCATATCCTTTTGCAGTGG
  GGTCGAGAGAGAAAGTAGCACGCCCGCCCCCTGCTGCGTCTTTCTAGGCCCTTCTTGCAAATCCCGGGCA
  TGAGCTACTCGCCGTCGGCTCTCTGCCACTTCGTCTCGCTCCCTACTCTCCTCCCCTTATTCCCGAGGCC
  CAGAAAAGAAAACAAAAACAAAAACCCAGCACATACAAGAAACATACAGTGTACCTCAAAAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004732.2
• Summary: This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. The encoded protein is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. The encoded protein forms a heterodimer with the potassium voltage-gated channel, shaker-related subfamily, member 5 gene product and regulates the activity of the alpha subunit. [provided by RefSeq, May 2012]
• Locus ID: 9196