ASXL1 (NM_001164603) Human 3' UTR Clone

CAT#: SC205289

3`UTR clone of additional sex combs like 1 (Drosophila) (ASXL1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ASXL1
• Synonyms: BOPS; MDS
• ACCN: NM_001164603
• Insert Size: 384
• Sequence Data:
  Insert Sequence

  >SC205289 3'UTR clone of NM_001164603
  The sequence shown below is from the reference sequence of NM_001164603. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCCTTTTCACGCTCAAGGTGTGAGCCACTGCACCAGGCCCCTTCATCTTAATTTTAATATATCTTTGA
  ATAAACACCATTGTATGAACCTGCTGTAAGCTTGGGAGTGGTCTGTTAGTCTACAGCTTGTGTCTGAGAT
  GTGCTAATTGAATATTTGCTCAGTACCTCATCTTAACTGCCTTTGGCTTTATGTTGCTTATCCTTCATAG
  TATCTTGTTCATTGGCCTTTTACATCCATAGGCATCACTTCTCTGATATTCGTTGTGCTCTTTTAATGGA
  TTAATGGTTTGCTTGGTTGGTTCCTCTAGTTAGACTGTAAACTCCTTGAGAGCAGAGTCTGTATTTTATT
  AATTACCCACAGTACTAGGTACATAGTTGCCTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001164603.1
• Summary: This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
• Locus ID: 171023