Microsomal Glutathione S transferase 1 (MGST1) (NM_020300) Human 3' UTR Clone

CAT#: SC205335

3`UTR clone of microsomal glutathione S-transferase 1 (MGST1) transcript variant 1b for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MGST1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MGST1
Synonyms GST12; MGST; MGST-I
ACCN NM_020300
Insert Size 385 bp
Sequence Data
>SC205335 3'UTR clone of NM_020300
The sequence shown below is from the reference sequence of NM_020300. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CATGGCTTACAGGTTGCTGAAAAGTAAATTGTACCTGTAAAGAAAATCATACAACTCAGCATCCAGTTGG
CTTTTTAAGAATTCTGTACTTCCAATTTATAATGAATACTTTCTTAGATTTTAGGTAGGAGGGGAGCAGA
GGAATTATGAACTGGGGTAAACCCATTTTGAATATTAGCATTGCCAATATCCTGTATTCTTGTTTTACAT
TTGGATTAGAAATTTAACATAGTAATTCTTAAGTCTTTTGTCTGATTTTTAAAGTACTTTCTTATAAATT
TGGATCATGTTATGATTTGTAACATTCACACAACACCTCACTTTTGAATCTATAAAAGAATTGCACGTAT
GAGAAACCTATATTTCAATACTGCTGAAACAGACA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_020300.3
Summary 'The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]'
Locus ID 4257

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.