STK19 (NM_004197) Human 3' UTR Clone

CAT#: SC205336

3`UTR clone of serine/threonine kinase 19 (STK19) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "STK19"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol STK19
Synonyms D6S60; D6S60E; G11; HLA-RP1; RP1
ACCN NM_004197
Insert Size 443
Sequence Data
>SC205336 3'UTR clone of NM_004197
The sequence shown below is from the reference sequence of NM_004197. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCATCTCTACCACTTCAGGAACCCTCCTCCGCCTGCCAGAGACATGAAGATTCTGCTCATCATTGCTCAG
CTCCTCAGAGTGGGCCGGGAGGGGACTAGAAGAGCTGCATGATGGTGGCTGAGACAGGGTCACCTTGGGA
AGGCTTGGGAGCCAGGATGAGTGTCGGGCTCTCGTGTGTGCAAAAGGTCAGATGTGACTGCTGCTGTTTG
CCTGGTTTCTGACCCAGTGGTGGGGTTTGAGCAATGCTTCTCTGCCCTTCCATGGAAAGTGGAACCAGAA
ATGGTGCCAAGGCTGTGGCTGTTCCCTTTCGTGTAAAATGGTGCTGTTATTACTCTGTCTTGAAATAGGA
AGGTGGGATTTCTGGGGAGGCTGGTGAAGGAGGGCAGGGTTCTTTTCTCTACGTGTCATGTTAAAATTGC
CAAATAAAGTACCTCTGCCTGTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004197.1
Summary This gene encodes a serine/threonine kinase which localizes predominantly to the nucleus. Its specific function is unknown; it is possible that phosphorylation of this protein is involved in transcriptional regulation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6 and expresses two transcript variants. [provided by RefSeq, Jul 2008]
Locus ID 8859

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.