ATP2A1 (NM_004320) Human 3' UTR Clone

CAT#: SC205391

3`UTR clone of ATPase Ca++ transporting cardiac muscle fast twitch 1 (ATP2A1) transcript variant b for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP2A1
• Synonyms: ATP2A; SERCA1
• ACCN: NM_004320
• Insert Size: 376
• Sequence Data:
  Insert Sequence

  >SC205391 3'UTR clone of NM_004320
  The sequence shown below is from the reference sequence of NM_004320. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCAAGTTCGTTGCTCGGAACTACCTAGAGGGATAACTGTTCCCCCTCCTCCATCTCTGAGCCCGTGTCA
  CAGATCCAGAAGATGAAAGAAGGAAGTGAGCATCCTTTTGCTCTGTCCTCCCCACCCCGATAGTGACACA
  TCTTCAGGCAGAGCTGTGGCACAGACCCCCGTCCTGTCCCCCACACCCGTGTCATGTGTCTGTTTATAAA
  CATGTCCCCTTCCCTTTCCTTCCCCCTCGGCCACCCGCCTCCCTCTCAACCTTGTAAATTCCCCTTCCCA
  ACCCCGAGGGGCTTGCAGGGACAAGGCGACCGACTGCGCTGAGCTGCTTATTTATTGAAAATAAACGACG
  GAAAAGTCTGGCCTTGCCTCTGTGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004320.3
• Summary: This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
• Locus ID: 487