TRIM21 (NM_003141) Human 3' UTR Clone

CAT#: SC205437

3`UTR clone of tripartite motif-containing 21 (TRIM21) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TRIM21
• Synonyms: RNF81; Ro/SSA; RO52; SSA; SSA1
• ACCN: NM_003141
• Insert Size: 386 bp
• Sequence Data:
  Insert Sequence

  >SC205437 3'UTR clone of NM_003141
  The sequence shown below is from the reference sequence of NM_003141. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATCACAAGGATCCACTGACTATTGATGGCTTTCTCTGGACACTGCCACTCTCCCCATTGGCACCGCTTC
  TCAGCCACAAACCCTGCCTCTTTTCCCCATGAACTCTGAACCACCTTTGTCTCTGCAGAGGCATCCGGAT
  CCCAGCAAGCGAGCTTTAGCAGGGAAGTCACTTCACCATCAACATTCCTGCCCCAGATGGCTTTGTGATT
  CCCTCCAGTGAAGCAGCCTCCTTATATTTGGCCCAAACTCATCTTGATCAACCAAAAACATGTTTCTGCC
  TTCTTTATGGGACTTAAGTTTTTTTTTTCTCCTCTCCATCTCTAGGATGTCGTCTTTGGTGAGATCTCTA
  TTATATCTTGTATGGTTTGCAAAAGGGCTTCCTAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003141.3
• Summary: 'This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The encoded protein is part of the RoSSA ribonucleoprotein, which includes a single polypeptide and one of four small RNA molecules. The RoSSA particle localizes to both the cytoplasm and the nucleus. RoSSA interacts with autoantigens in patients with Sjogren syndrome and systemic lupus erythematosus. Alternatively spliced transcript variants for this gene have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]'
• Locus ID: 6737