KCNK7 (NM_033348) Human 3' UTR Clone

CAT#: SC205440

3`UTR clone of potassium channel subfamily K member 7 (KCNK7) transcript variant B for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNK7"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KCNK7
Synonyms K2p7.1; TWIK3
ACCN NM_033348
Insert Size 417
Sequence Data
>SC205440 3'UTR clone of NM_033348
The sequence shown below is from the reference sequence of NM_033348. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTCTTGGTGGAGGGACCTCACTCCAGGGCACGGCGTGGGAGGGGTAGTCGAAGAGCTCTGGTGGCAGCGT
TGAGAAGGGGGTTACTTGCTTCTAGGACTCTTGGCCATGCTGCTGGCAGTGGAGACCTTCTCTGAGCTGC
CGCAGGTCCGTGCCATGGGGAAGTTCTTCAGACCCAGTGGTCCTGTGACTGCTGAGGACCAAGGTGGCAT
CCTAGGGCAGGATGAACTGGCTCTGAGCACCCTGCCGCCCGCGGCCCCAGCTTCAGGACAAGCCCCTGCT
TGCTGAAGCGTCAGGTGACCGAGTTCAGCTCCGTAAGGTGGCGGCACCTGAGGAGGAAGCAGCCAGGAGT
GGCTGGGGAAGAATCTGGAGATGGAGCCGCGGTGAGGGTGGGCGGGAGGCCTCAGGGGATACTGTTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033348.1
Summary This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel; however, it may require other non-pore-forming proteins for activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 10089

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.