IL5RA (NM_175724) Human 3' UTR Clone

CAT#: SC205451

3`UTR clone of interleukin 5 receptor alpha (IL5RA) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL5RA
• Synonyms: CD125; CDw125; HSIL5R3; IL5R
• ACCN: NM_175724
• Insert Size: 420 bp
• Sequence Data:
  Insert Sequence

  >SC205451 3'UTR clone of NM_175724
  The sequence shown below is from the reference sequence of NM_175724. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTGAGTGGAGCCAACCTATTTATGTGGGTAAGTAGCTTATGTTTATTTTACATTGGCAGCCTTCCTTGT
  GATCAAAAAAGGTAATCCCAGAAACGTACCCGTTCACTCGTGGGTCTTAAAATGGTTTCATATCTCTATT
  GTGACTAATTTTCTCTCGGTCTACTGCCTTTTCAATCAGGAATAGATTTGCCATGAAGCCAGTGAAGTTT
  TTAAGTGTCTAGGCTTCTCATTAGCGCCAACTCTCCTAGACCTGGTGCCTGTTTTTTTTCCAAGTTTTGT
  TTCTACTTCTATCCATTTTTTAAATTAAACTTTTTATTTTGAAATAATTATCACACTCACAAGCTGTGGG
  AAGAAATAATAGAGATCCTGTGTCTCTTTCATCCAGTTTTCCTCAAGGGTAACATCTTACAAAACTATAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_175724.2
• Summary: 'The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]'
• Locus ID: 3568