PP4R4 (PPP4R4) (NM_020958) Human 3' UTR Clone

CAT#: SC205453

3`UTR clone of protein phosphatase 4 regulatory subunit 4 (PPP4R4) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PPP4R4
• Synonyms: CFAP14; KIAA1622; PP4R4
• ACCN: NM_020958
• Insert Size: 381
• Sequence Data:
  Insert Sequence

  >SC205453 3'UTR clone of NM_020958
  The sequence shown below is from the reference sequence of NM_020958. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTTGTCCAGAGGGTGTGACTCTGTGGAGGAGAACACTTACTGTGGACAGTCCCAGATGTTGAAGTCAGC
  ACAACAAGAGAAAAACCCAAATCCTGATAAGACTTGAGGATTTTTCGAAAATTAAATGCAAAATAGTTGG
  GGCAAATGTTGCTGCGGGAGTCAAGACTAAGTAATACAGTAAGAAGATATGAAGTTGGAGAGCTTCTCAT
  GTTCTTCCTTTGTATAAAGTTTGCATACGTACAAAACCCAGGACTTTAATGACTTTAAGAGGGGGCAGAA
  TTGCATCTCTTGGAAGTTAACAGACTCATGTGAACTGGAATGTACGTTGTGGCCCTCACAATTGATTTTA
  ATATTTATTTGCAAAGTCCTTTCTGTTTCTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_020958.2
• Summary: The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]
• Locus ID: 57718