Carboxylesterase 7 (CES5A) (NM_001143685) Human 3' UTR Clone

CAT#: SC205469

3`UTR clone of carboxylesterase 7 (CES7) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CES5A
• Synonyms: CAUXIN; CES4C1; CES5; CES7; HEL126
• ACCN: NM_001143685
• Insert Size: 328
• Sequence Data:
  Insert Sequence

  >SC205469 3'UTR clone of NM_001143685
  The sequence shown below is from the reference sequence of NM_001143685. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCTCCTCCAGCCTTTCTTTTTCTTTTGTGCTCCTTGAGAAGTTATCTTTCTGTGATTTTGGTTTCCCTT
  CTCCTCCCATAATTTCTCCCGCAATCATTAGCTTCTTTCTGAGCTCAGCTGCTTTCTATGGGGATCCTTG
  CAAAACAAGCTGCTTTCGCTGATATTTTATGGACTTAGGAATGATCCTTACAGAATTCTTTTCAACATCA
  AAAAGTGCAATTTGTCTTGGAAGGCAACAAGATTTCTTCAATAAATTTGGAAGAGGGCTGGCCTATTAGT
  TGTCATAATAATGGTTTTGTAACTCATATGAAATAAAATCAGAATGTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001143685.1
• Summary: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
• Locus ID: 221223