TIMM9 (NM_012460) Human 3' UTR Clone

CAT#: SC205535

3`UTR clone of translocase of inner mitochondrial membrane 9 homolog (yeast) (TIMM9) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TIMM9
• Synonyms: TIM9; TIM9A
• ACCN: NM_012460
• Insert Size: 411
• Sequence Data:
  Insert Sequence

  >SC205535 3'UTR clone of NM_012460
  The sequence shown below is from the reference sequence of NM_012460. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCCAAAGCAGGACTCCTTGGCCAACCACGATAGAGAAGTCCTGATGGATGAACTTTTGATGAAAGATTG
  CCAACAGCTGCTTTATTGGAAATGAGGACTCATCTGATAGAATCCCCTGAAAGCAGTAGCCACCATGTTC
  AACCATCTGTCATGACTGTTTGGCAAATGGAAACCGCTGGAGAAACAAAATTGCTATTTACCAGGAATAA
  TCACAATAGAAGGTCTTATTGTTCAGTGAAATAATAAGATGCAACATTTGTTGAGGCCTTATGATTCAGC
  AGCTTGGTCACTTGATTAGAAAAATAAACCATTGTTTCTTCAATTGTGACTGTTAATTTTAAAGCAACTT
  ATGTGTTCGATCATGTATGAGATAGAAAAATTTTTATTACTCAAAGTAAAATAAATGGAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012460.2
• Summary: TIMM9 belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane. [supplied by OMIM, Apr 2004]
• Locus ID: 26520