CEBPD (NM_005195) Human 3' UTR Clone

CAT#: SC205577

3`UTR clone of CCAAT/enhancer binding protein (C/EBP) delta (CEBPD) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CEBPD
• Synonyms: C/EBP-delta; CELF; CRP3; NF-IL6-beta
• ACCN: NM_005195
• Insert Size: 415
• Sequence Data:
  Insert Sequence

  >SC205577 3'UTR clone of NM_005195
  The sequence shown below is from the reference sequence of NM_005195. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACAGCAGACTGCCGGTAACGCGCGGCCGGGGCGGGAGAGACTCAGCAACGACCCATACCTCAGACCCGAC
  GGCCCGGAGCGGAGCGCGCCCTGCCCTGGCGCAGCCAGAGCCGCCGGGTGCCCGCTGCAGTTTCTTGGGA
  CATAGGAGCGCAAAGAAGCTACAGCCTGGACTTACCACCACTAAACTGCGAGAGAAGCTAAACGTGTTTA
  TTTTCCCTTAAATTATTTTTGTAATGGTAGCTTTTTCTACATCTTACTCCTGTTGATGCAGCTAAGGTAC
  ATTTGTAAAAAGAAAAAAAACCAGACTTTTCAGACAAACCCTTTGTATTGTAGATAAGAGGAAAAGACTG
  AGCATGCTCACTTTTTTATATTAATTTTTACAGTATTTGTAAGAATAAAGCAGCATTTGAAATCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005195.3
• Summary: The protein encoded by this intronless gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-alpha. The encoded protein is important in the regulation of genes involved in immune and inflammatory responses, and may be involved in the regulation of genes associated with activation and/or differentiation of macrophages. The cytogenetic location of this locus has been reported as both 8p11 and 8q11. [provided by RefSeq, Sep 2010]
• Locus ID: 1052