CSPS (SULT1A3) (NM_003166) Human 3' UTR Clone

CAT#: SC205590

3`UTR clone of sulfotransferase family cytosolic 1A phenol-preferring member 3 (SULT1A3) transcript variant 1

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SULT1A3
• Synonyms: HAST; HAST3; M-PST; MGC117469; ST1A5; STM; SULT1A4; TL-PST
• ACCN: NM_003166
• Insert Size: 430 bp
• Sequence Data:
  Insert Sequence

  >SC205590 3'UTR clone of NM_003166
  The sequence shown below is from the reference sequence of NM_003166. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGAGAAGATGGCAGGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGAGAGGGGCTCCTGGAGTCACTGCA
  GAGGGAGTGTGCGAATCTACCCTGACCAATGGGCTCAAGAATAAAGTATGATTTTTGAGTCAGGCACAGT
  GGCTCATGTCTGCAATCCCAGCGATTTGGGAGGTTGAGCTGGTAGGATCACAATAGGCCACGAATTTGAG
  ACCAGCCTGGTAAAATAGTGAGACCTCATCTCTACAAAGATGTAAAAAAATTAGCCACATGTGCTGGCAC
  TTACCTGTAGTCCCAGCTACTTGGGAAGCAGAGGCTGGAGGATCATTTCAGCCCAGGAGGTTGTGGATAC
  AGTGAGTTATGACATGCCCATTCACTACAGCCTGGATGACAAGCAAGACCCTCCCTCCAAAGAAAATAAA
  GCTCAATTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003166.3
• Summary: 'Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. This gene is the most centromeric of the four sulfotransferase genes. Read-through transcription exists between this gene and the upstream SLX1A (SLX1 structure-specific endonuclease subunit homolog A) gene that encodes a protein containing GIY-YIG domains. [provided by RefSeq, Nov 2010]'
• Locus ID: 6818