PPM1G (NM_177983) Human 3' UTR Clone

CAT#: SC205604

3`UTR clone of protein phosphatase 1G (formerly 2C) magnesium-dependent gamma isoform (PPM1G) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PPM1G
• Synonyms: PP2CG; PP2CGAMMA; PPP2CG
• ACCN: NM_177983
• Insert Size: 439 bp
• Sequence Data:
  Insert Sequence

  >SC205604 3'UTR clone of NM_177983
  The sequence shown below is from the reference sequence of NM_177983. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGGCAACAGCGACAAGAAGAAGAAGGCCAAGCGAGACTAGCAGTCATCCAGACCCCTGCCCACCTAGAC
  TGTTTTCTGAGCCCTCCGGACCTGAGACTGAGTTTTGTCTTTTTCCTTTAGCCTTAGCAGTGGGTATGAG
  GTGTGCAGGGGGAGCTGGGTGGCTTCACTCCGCCCATTCCAAAGAGGGCTCTCCCTCCACACTGCAGCCG
  GGAGCCTCTGCTGTCCTTCCCAGCCGCCTCTGCTCCTCGGGCTCATCACCGGTTCTGTGCCTGTGCTCTG
  TTGTGTTGGAGGGAAGGACTGGCGGTTCTGGTTTTTACTCTGTGAACTTTATTTAAGGACATTCTTTTTT
  ATTGGCGGCTCCATGGCCCTCGGCCGCTTGCACCCGCTCTCTGTTGTACACTTTCAATCAACACTTTTTC
  AGACTAAAGGCCAAAACCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_177983.1
• Summary: 'The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. Studies of a similar gene in mice suggested a role of this phosphatase in regulating cell cycle progression. [provided by RefSeq, Apr 2010]'
• Locus ID: 5496