PIGT (NM_015937) Human 3' UTR Clone

CAT#: SC205628

3`UTR clone of phosphatidylinositol glycan anchor biosynthesis class T (PIGT) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PIGT
• Synonyms: CGI-06; MCAHS3; NDAP; PNH2
• ACCN: NM_015937
• Insert Size: 464
• Sequence Data:
  Insert Sequence

  >SC205628 3'UTR clone of NM_015937
  The sequence shown below is from the reference sequence of NM_015937. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGGCCAACCTTATCCGGCGCGCCCGAGGTGTCCCCCCACTCTGATTCTTGCCCTTTCCAGCAGCTGCA
  GCTGCCGTTTCTCTCTGGGGAGGGGAGCCCAAGGGCTGTTTCTGCCACTTGCTCTCCTCAGAGTTGGCTT
  TTGAACCAAAGTGCCCTGGACCAGGTCAGGGCCTACAGCTGTGTTGTCCAGTACAGGAGCCACGAGCCAA
  ATGTGGCATTTGAATTTGAATTAACTTAGAAATTCATTTCCTCACCTGTAGTGGCCACCTCTATATTGAG
  GTGCTCAATAAGCAAAAGTGGTCGGTGGCTGCTGTATTGGACAGCACAGAAAAAGATTTCCATCACCACA
  GAAAGGTCGGCTGGCAGCACTGGCCAAGGTGATGGGGTGTGCTACACAGTGTATGTCACTGTGTAGTGGA
  TGGAGTTTACTGTTTGTGGAATAAAAACGGCTGTTTCCGTGGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_015937.3
• Summary: This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
• Locus ID: 51604