Complement C5 (C5) (NM_001735) Human 3' UTR Clone

CAT#: SC205644

3`UTR clone of complement component 5 (C5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C5
• Synonyms: C5a; C5b; C5D; CPAMD4; ECLZB
• ACCN: NM_001735
• Insert Size: 417 bp
• Sequence Data:
  Insert Sequence

  >SC205644 3'UTR clone of NM_001735
  The sequence shown below is from the reference sequence of NM_001735. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATGAATTTGCCGAAGATATCTTTTTAAATGGATGCTAAAATTCCTGAAGTTCAGCTGCATACAGTTTGC
  ACTTATGGACTCCTGTTGTTGAAGTTCGTTTTTTTGTTTTCTTCTTTTTTTAAACATTCATAGCTGGTCT
  TATTTGTAAAGCTCACTTTACTTAGAATTAGTGGCACTTGCTTTTATTAGAGAATGATTTCAAATGCTGT
  AACTTTCTGAAATAACATGGCCTTGGAGGGCATGAAGACAGATACTCCTCCAAGGTTATTGGACACCGGA
  AACAATAAATTGGAACACCTCCTCAAACCTACCACTCAGGAATGTTTGCTGGGGCCGAAAGAACAGTCCA
  TTGAAAGGGAGTATTACAAAAACATGGCCTTTGCTTGAAAGAAAATACCAAGGAACAGGAAACTGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001735.2
• Summary: 'This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the C5 alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mutations in this gene cause complement component 5 deficiency, a disease characterized by recurrent bacterial infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]'
• Locus ID: 727