Complement C5 (C5) (NM_001735) Human 3' UTR Clone

CAT#: SC205644

3`UTR clone of complement component 5 (C5) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol C5
Synonyms C5a; C5b; C5D; CPAMD4; ECLZB
ACCN NM_001735
Insert Size 417 bp
Sequence Data
>SC205644 3'UTR clone of NM_001735
The sequence shown below is from the reference sequence of NM_001735. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATGAATTTGCCGAAGATATCTTTTTAAATGGATGCTAAAATTCCTGAAGTTCAGCTGCATACAGTTTGC
ACTTATGGACTCCTGTTGTTGAAGTTCGTTTTTTTGTTTTCTTCTTTTTTTAAACATTCATAGCTGGTCT
TATTTGTAAAGCTCACTTTACTTAGAATTAGTGGCACTTGCTTTTATTAGAGAATGATTTCAAATGCTGT
AACTTTCTGAAATAACATGGCCTTGGAGGGCATGAAGACAGATACTCCTCCAAGGTTATTGGACACCGGA
AACAATAAATTGGAACACCTCCTCAAACCTACCACTCAGGAATGTTTGCTGGGGCCGAAAGAACAGTCCA
TTGAAAGGGAGTATTACAAAAACATGGCCTTTGCTTGAAAGAAAATACCAAGGAACAGGAAACTGAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001735.2
Summary 'This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the C5 alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mutations in this gene cause complement component 5 deficiency, a disease characterized by recurrent bacterial infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]'
Locus ID 727

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.