PKC zeta (PRKCZ) (NM_001033582) Human 3' UTR Clone

CAT#: SC205647

3`UTR clone of protein kinase C zeta (PRKCZ) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRKCZ
• Synonyms: PKC-ZETA; PKC2
• ACCN: NM_001033582
• Insert Size: 392 bp
• Sequence Data:
  Insert Sequence

  >SC205647 3'UTR clone of NM_001033582
  The sequence shown below is from the reference sequence of NM_001033582. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATTGCTGTCCACCGAGGAGTCGGTGTGAGGCCGCGTGCGTCTCTGTCGTGGACACGCGTGATTGACCCTT
  TAACTGTATCCTTAACCACCGCATATGCATGCCAGGCTGGGCACGGCTCCGAGGGCGGCCAGGGACAGAC
  GCTTGCGCCGAGACCGCAGAGGGAAGCGTCAGCGGGCGCTGCTGGGAGCAGAACAGTCCCTCACACCTGG
  GCCCGGGCAGGCCAGCTTCGTGCTGGAGGAACTTGCTGCTGTGCCTGCGTCGCGGCGGATCCGCGGGGAC
  CCTGCCGAGGGGGCTGTCATGCGGTTTCCAAGGTGCACATTTTCCACGGAAACAGAACTCGATGCACTGA
  CCTGCTCCGCCAGGAAAGTGAGCGTGTAGCGTCCTGAGGAAT
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001033582.1
• Summary: 'Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
• Locus ID: 5590