Arginase 1 (ARG1) (NM_000045) Human 3' UTR Clone

CAT#: SC205656

3`UTR clone of arginase liver (ARG1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ARG1
• ACCN: NM_000045
• Insert Size: 441 bp
• Sequence Data:
  Insert Sequence

  >SC205656 3'UTR clone of NM_000045
  The sequence shown below is from the reference sequence of NM_000045. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGGGTAATCACAAGCCTATTGACTACCTTAACCCACCTAAGTAAATGTGGAAACATCCGATATAAATC
  TCATAGTTAATGGCATAATTAGAAAGCTAATCATTTTCTTAAGCATAGAGTTATCCTTCTAAAGACTTGT
  TCTTTCAGAAAAATGTTTTTCCAATTAGTATAAACTCTACAAATTCCCTCTTGGTGTAAAATTCAAGATG
  TGGAAATTCTAACTTTTTTGAAATTTAAAAGCTTATATTTTCTAACTTGGCAAAAGACTTATCCTTAGAA
  AGAGAAGTGTACATTGATTTCCAATTAAAAATTTGCTGGCATTAAAAATAAGCACACTTACATAAGCCCC
  CATACATAGAGTGGGACTCTTGGAATCAGGAGACAAAGCTACCACATGTGGAAAGGTACTATGTGTCCAT
  GTCATTCAAAAAATGTGATTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000045.2
• Summary: 'Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exist (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type I isoform encoded by this gene, is a cytosolic enzyme and expressed predominantly in the liver as a component of the urea cycle. Inherited deficiency of this enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]'
• Locus ID: 383