SEMA6D (NM_024966) Human 3' UTR Clone

CAT#: SC205658

3`UTR clone of sema domain transmembrane domain (TM) and cytoplasmic domain (semaphorin) 6D (SEMA6D) transcript variant 6 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SEMA6D
• Synonyms: FLJ11598; KIAA1479
• ACCN: NM_024966
• Insert Size: 441
• Sequence Data:
  Insert Sequence

  >SC205658 3'UTR clone of NM_024966
  The sequence shown below is from the reference sequence of NM_024966. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACAGCGTATTACTGGAAGAGATTGAAGCCTACAACCATGCAAAGTAGGTATATGTTACGAGAACGCCCTT
  CAGCACTGCTCAAAAATTTTCGGCATGTATTTCATCTAGTCATGTCCTTTTGGTCCTCTAAATTAGCAGT
  GGTTTGGCATAATAGTGTTTTGTGTTTTTTTTCTCATTGAAATAAATCTTGGGTTTGTTTTTTTCCCGAG
  CCTGCTAGGGCGAGGGGGGTGAATGGTTGATGAGTTTAAAAATAATGCAGCCCTTGTTTTTCACCTGTAG
  AATATGAGAACATTTTAACAGCACCTCTCTTATCTTGCAGATATATTCCAAGATGCTACATGCAGCAGAC
  AGCTGTGAGCTTGCATACACACACACACAAATATACATGCACATACATACACAGAATGCAGTACTAGTTA
  AGTATTTCCTTCCTATCTTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_024966.2
• Summary: Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
• Locus ID: 80031