PI 3 Kinase regulatory subunit 4 (PIK3R4) (NM_014602) Human 3' UTR Clone

CAT#: SC205664

3`UTR clone of phosphoinositide-3-kinase regulatory subunit 4 (PIK3R4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PIK3R4
• Synonyms: p150; VPS15
• ACCN: NM_014602
• Insert Size: 408
• Sequence Data:
  Insert Sequence

  >SC205664 3'UTR clone of NM_014602
  The sequence shown below is from the reference sequence of NM_014602. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGATGGGATTGTGAAGGTGTGGAAATAAAACCTACTGATTTGTATAAATTTTAATAGTTATAAATATAA
  TACTATAACTCGAGAAAAGGCATTTCTAGAGAACAGATTCATTTGCTTAATTTTCAAAATTATGTCTCCA
  TATTACTGTTTCATGACTGACTGACTAAATGACACCCAAAATGGTTAAGATGTACTTGACTAGTTTACTT
  ATGCATCTCTTTGCAAGAATCAGCCAGCCAACAATGTCTGGGATTTTTATTGTATATGTTATAGAGGTGA
  GAAATGTAAAATATGAAAATGAATATGTTTATTTTGTATTGAAAAAGATGGTTGAAAAGATGGTTGTAAG
  CTATTATAGTATAAACACATTTTTGCTATTAAAAATGCTATTCAAAGCAGTTAAACTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014602.2
• Summary: Regulatory subunit of the PI3K complex that mediates formation of phosphatidylinositol 3-phosphate; different complex forms are believed to play a role in multiple membrane trafficking pathways: PI3KC3-C1 is involved in initiation of autophagosomes and PI3KC3-C2 in maturation of autophagosomes and endocytosis. Involved in regulation of degradative endocytic trafficking and cytokinesis, probably in the context of PI3KC3-C2 (PubMed:20643123). [UniProtKB/Swiss-Prot Function]
• Locus ID: 30849