C1S (NM_001734) Human 3' UTR Clone

CAT#: SC205665

3`UTR clone of complement component 1 s subcomponent (C1S) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C1S
• Synonyms: EDSPD2
• ACCN: NM_001734
• Insert Size: 385 bp
• Sequence Data:
  Insert Sequence

  >SC205665 3'UTR clone of NM_001734
  The sequence shown below is from the reference sequence of NM_001734. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TATGCAGGAAAATAGCACCCCCCGTGAGGACTAATCCAGATACATCCCACCAGCCTCTCCAAGGGTGGTG
  ACCAATGCATTACCTTCTGTTCCTTATGATATTCTCATTATTTCATCATGACTGAAAGAAGACACGAGCG
  AATGATTTAAATAGAACTTGATTGTTGAGACGCCTTGCTAGAGGTAGAGTTTGATCATAGAATTGTGCTG
  GTCATACATTTGTGGTCTGACTCCTTGGGGTCCTTTCCCCGGAGTACCTATTGTAGATAACACTATGGGT
  GGGGCACTCCTTTCTTGCACTATTCCACAGGGATACCTTAATTCTTTGTTTCCTCTTTACCTGTTCAAAA
  TTCCATTTACTTGATCATTCTCAGTATCCACTGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001734.3
• Summary: 'This gene encodes a serine protease, which is a major constituent of the human complement subcomponent C1. C1s associates with two other complement components C1r and C1q in order to yield the first component of the serum complement system. Defects in this gene are the cause of selective C1s deficiency. [provided by RefSeq, Mar 2009]'
• Locus ID: 716