MSI2 (NM_138962) Human 3' UTR Clone

CAT#: SC205671

3`UTR clone of musashi homolog 2 (Drosophila) (MSI2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MSI2
• Synonyms: MSI2H
• ACCN: NM_138962
• Insert Size: 438
• Sequence Data:
  Insert Sequence

  >SC205671 3'UTR clone of NM_138962
  The sequence shown below is from the reference sequence of NM_138962. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACCTTTGATTGCAACGGCCTTTACAAATGGATACCATTGAGCAGGTGCTTTCGTTGCCATCTCACTCT
  GAGAGCATACCTGGATGTCCAGGCAAGACTGGGCGAAGTTTCTGAGTGGCCCTTTGTTTAGGTGATGTCC
  TCAGACCTGGACCCCCACCAGCCTCACTCCCCATCCCAACCAGAGATGGCTCACTTCGGATCGAGGGTTG
  ACTACATCTCATCATCTCACGAATCTGCTGTAATATAAGACAACAGCTTTTAAATGTGTATATAACCCAT
  GATTTCGGTTTTGTTTTGTTTTGTTTTTCTTGATGGTTTCCCTCTCCCTCCCTCTCTTCCCATTCTCCTT
  TTAAATCTCTTTGAATCACATTTGGTAGTGATTTTGACTTAGTCCAGTAGTCACATAGCTTTAATATCTA
  GTTCAAAGCTAACCATAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_138962.2
• Summary: This gene encodes an RNA-binding protein that is a member of the Musashi protein family. The encoded protein is transcriptional regulator that targets genes involved in development and cell cycle regulation. Mutations in this gene are associated with poor prognosis in certain types of cancers. This gene has also been shown to be rearranged in certain cancer cells. [provided by RefSeq, Apr 2016]
• Locus ID: 124540