Apc11 (ANAPC11) (NM_001002249) Human 3' UTR Clone

CAT#: SC205693

3`UTR clone of anaphase promoting complex subunit 11 (ANAPC11) transcript variant 7 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ANAPC11"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ANAPC11
Synonyms APC11; Apc11p; HSPC214
ACCN NM_001002249
Insert Size 410
Sequence Data
>SC205693 3'UTR clone of NM_001002249
The sequence shown below is from the reference sequence of NM_001002249. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGAAGTTCAAGGAGTGAGGCCCGACCTGGCTCTCGCTGGAGGGGCATCCTGAGACTCCTTCCTCATGCT
GGCGCCGATGGCTGCTGGGGACAGCGCCCCTGAGCTGCAACAAGGTGGAAACAAGGGCTGGAGCTGCGTT
TGTTTTGCCATCACTATGTTGACACTTTTATCCAATAAGTGAAAACTCATTAAACTACTCAAATCTTGCT
GGAGGCCTCTGGGTGCCTGTGTTCTCGGCATATAGATGTGGTCTCGGTGTGTTTTGATATGAAAACTCTC
ATGAATAAACATCTCCGTGAAACGCCAAGGCCCTCGTCAAACCCTGAGTCATGACTGGGAGGAGAAGGAG
CAGGATCAGACGGTAGAGCCTGGGGCATGCTCTTCAGGCATGCTCTTGCCTGCTGGATTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001002249.1
Summary Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex. [UniProtKB/Swiss-Prot Function]
Locus ID 51529

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.