KCNH7 (NM_033272) Human 3' UTR Clone

CAT#: SC205697

3`UTR clone of potassium voltage-gated channel subfamily H (eag-related) member 7 (KCNH7) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNH7"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KCNH7
Synonyms ERG3; HERG3; Kv11.3
ACCN NM_033272
Insert Size 434
Sequence Data
>SC205697 3'UTR clone of NM_033272
The sequence shown below is from the reference sequence of NM_033272. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGCATGTTTCTGATCCTGGTCTTCCAGGGAAATAATCATTTTGTACTATTTACTCCACATACAATGTAAG
TGCTTTTAATGGCTGTTTTCCTTTTTCTATTTAAATCCTCTCTACTTGACTCAGGGGCTCACAAGGTACC
ATTATATGCAAAAGTACTGTATATTTTCCTAAATTGAAGCTTGTAAGGTAAAACTGAGCAGTTAGGATGT
AAATATACATAAGAACTTTTGGTTCCAAATGTTAAAACTGCCAGCATCTCACGGCACCTTATTTTTTATT
TTTATTTTTTAAATCACATGCATGTTAGGAAACTCCAATTTCTCTTGCATGGAGACTCCTATTTACTGCT
TTTACTAAACCAGTACTTCGTTATGAAAATGCCTTCCACGCAAATAAGAAACCAAGGGATAAAACTGTTC
ATGGATGCAACTCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033272.2
Summary Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Locus ID 90134

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.