HSD3B1 (NM_000862) Human 3' UTR Clone

CAT#: SC205702

3`UTR clone of hydroxy-delta-5-steroid dehydrogenase 3 beta- and steroid delta-isomerase 1 (HSD3B1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSD3B1
• Synonyms: 3BETAHSD; HSD3B; HSDB3; HSDB3A; SDR11E1
• ACCN: NM_000862
• Insert Size: 421 bp
• Sequence Data:
  Insert Sequence

  >SC205702 3'UTR clone of NM_000862
  The sequence shown below is from the reference sequence of NM_000862. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACAAGGAGACCCTGAAGTCCAAGACTCAGTGATTTAAGGATGACAGAGATGTGCATGTGGGTATTGTTA
  GGAGATGTCATCAAGCTCCACCCTCCTGGCCTCATACAGAAAGTGACAAGGGCACAAGCTCAGGTCCTGC
  TGCCTCCCTTTCATACAATGGCCAACTTATTGTATTCCTCATGTCATCAAAACCTGCGCAGTCATTGGCC
  CAACAAGAAGGTTTCTGTCCTAATCATATACCAGAGGAAAGACCATGTGGTTTGCTGTTACCAAATCTCA
  GTAGCTGATTCTGAACAATTTAGGGACTCTTTTAACTTGAGGGTCGTTTTGACTACTAGAGCTCCATTTC
  TACTCTTAAATGAGAAAGGATTTCCTTTCTTTTTAATCTTCCATTCCTTCACATAGTTTGATAAAAAGAT
  C
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000862.2
• Summary: 'The protein encoded by this gene is an enzyme that catalyzes the oxidative conversion of delta-5-3-beta-hydroxysteroid precursors into delta-4-ketosteroids, which leads to the production of all classes of steroid hormones. The encoded protein also catalyzes the interconversion of 3-beta-hydroxy- and 3-keto-5-alpha-androstane steroids. [provided by RefSeq, Jun 2016]'
• Locus ID: 3283