LAMA3 (NM_198129) Human 3' UTR Clone

CAT#: SC205720

3`UTR clone of laminin alpha 3 (LAMA3) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LAMA3
• Synonyms: BM600; E170; LAMNA; LOCS
• ACCN: NM_198129
• Insert Size: 445 bp
• Sequence Data:
  Insert Sequence

  >SC205720 3'UTR clone of NM_198129
  The sequence shown below is from the reference sequence of NM_198129. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTCAGTCTGAATGGTTGTCCTGACCAGTAACCCAAGCCTATTTCACAGCAAGGAAATTCACCTTCAAAAG
  CACTGATTACCCAATGCACCTCCCTCCCCAGCTCGAGATCATTCTTCACTCAGGACACAAACCAGACAGG
  TTTAATAGCGAATCTAATTTTGAATTCTGACCATGGATACCCATCACTTTGGCATTCAGTGCTACATGTG
  TATTTTATATAAAAATCCCATTTCTTGAAGATAAAAAAATTGTTATTCAAATTGTTATGCACAGAATGTT
  TTTGGTAATATTAATTTCCACTAAAAAATTAAATGTCTTTTAAGAAACATTCTTTTCCACTTGTTAAAAA
  AATTAAATATATTTTAAAGCACTTTAAGAATATGAAACTTTCATATATGTTAAAGGATTATAATTTATGG
  AATTAAAAAATGCAGTGTAGTCCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_198129.1
• Summary: 'The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]'
• Locus ID: 3909