IL9R (NM_002186) Human 3' UTR Clone

CAT#: SC205745

3`UTR clone of interleukin 9 receptor (IL9R) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL9R
• Synonyms: CD129; IL-9R
• ACCN: NM_002186
• Insert Size: 417
• Sequence Data:
  Insert Sequence

  >SC205745 3'UTR clone of NM_002186
  The sequence shown below is from the reference sequence of NM_002186. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCTGTCCTCAGCAAGGCTCGGTCCTGGACATTCTAGGTCCCTGACTCGCCAGATGCATCATGTCCATTT
  TGGGAAAATGGACTGAAGTTTCTGGAGCCCTTGTCTGAGACTGAACCTCCTGAGAAGGGGCCCCTAGCAG
  CGGTCAGAGGTCCTGTCTGGATGGAGGCTGGAGGCTCCCCCCTCAACCCCTCTGCTCAGTGCCTGTGGGG
  AGCAGCCTCTACCCTCAGCATCCTGGCCACAAGTTCTTCCTTCCATTGTCCCTTTTCTTTATCCCTGACC
  TCTCTGAGAAGTGGGGTGTGGTCTCTCAGCTGTTCTGCCCTCATACCCTTAAAGGGCCAGCCTGGGCCCA
  GTGGACACAGGTAAGGCACCATGACCACCTGGTGTGACCTCTCTGTGCCTTACTGAGGCACCTTTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_002186.2
• Summary: The protein encoded by this gene is a cytokine receptor that specifically mediates the biological effects of interleukin 9 (IL9). The functional IL9 receptor complex requires this protein as well as the interleukin 2 receptor, gamma (IL2RG), a common gamma subunit shared by the receptors of many different cytokines. The ligand binding of this receptor leads to the activation of various JAK kinases and STAT proteins, which connect to different biologic responses. This gene is located at the pseudoautosomal regions of X and Y chromosomes. Genetic studies suggested an association of this gene with the development of asthma. Multiple pseudogenes on chromosome 9, 10, 16, and 18 have been described. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 3581