PCDH7 (NM_002589) Human 3' UTR Clone

CAT#: SC205784

3`UTR clone of protocadherin 7 (PCDH7) transcript variant a for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PCDH7
• Synonyms: BH-Pcdh; BHPCDH; PPP1R120
• ACCN: NM_002589
• Insert Size: 461 bp
• Sequence Data:
  Insert Sequence

  >SC205784 3'UTR clone of NM_002589
  The sequence shown below is from the reference sequence of NM_002589. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCAAACAGATGCGTCTACATCCATACATTACTGTGTTTGGCTGAATTCCACTCTAATATGATGCTCCA
  TTATGCACCATACTGTGATGACCTTTCTACTCCGAAACCTGCTGGAGCCTGCCCTTGGCCGTGGGGTGTC
  AGCCAATCACTGCTTGTTCCACTTGTTGTACATTTTATTTTTGAGTCTTTTTCTTTCTCATATACAGAAA
  AATAGTATGAAAATAAAATAAATGTATGAAACAGTATTAATGCAGAAATGTGCTACTAATGGATGTCTGA
  GTCACCAGAAATTCCATTCTTAAAGAGGCGGTTAGCACCTATTAGACGTAACAGTGATGTCTTTTAAAAA
  ATCCAAAAGCATATTGCAACAATAAGTTTGAGACTTTGTGTGAACAAAGGGAAATTCAGCCTCTTATGTC
  TTTGTCTTTAATACATTAAATACTGATTTTGAATAAAAATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002589.2
• Summary: 'This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]'
• Locus ID: 5099