D Amino Acid Oxidase (DAO) (NM_001917) Human 3' UTR Clone

CAT#: SC205786

3`UTR clone of D-amino-acid oxidase (DAO) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DAO
• Synonyms: DAAO; DAMOX; OXDA
• ACCN: NM_001917
• Insert Size: 413 bp
• Sequence Data:
  Insert Sequence

  >SC205786 3'UTR clone of NM_001917
  The sequence shown below is from the reference sequence of NM_001917. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTCCAGAATGCCACCATCCCACCTCTGAAGACTCCAGTGACTGCTGCCTCCCCCCACAAGAACTCCCTTC
  TCCCCTCAGCCAATGAATCAATGTGCTCCTTCATAAGCCATTGCTTCTCCCTCACTTCTTTCCTCAAAGA
  AGCATGAGGTGAGAGAAAGCCACAAAGTCAGTGCCTGGAGAAGGGTTCAGCCCAACATGGGGCCCCTCTC
  ATCACTGAAATCCCTCTACCTTCTCTGGGTCTGGCATTATAAAGAACAGCTGAGGCTGTCATTCCATGAG
  TCTTCAGAAGAAAGGACAGCTCAGAAAATCAAAGAGGCCAACTGCCCAGAGCCACAGAAAATGGAGGATA
  ATTGAGGCTAAGTAACCTGATTACAAGTTGTACTAACATATTAAAGGTTCTGAAAAGTCCTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001917.4
• Summary: 'This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia. [provided by RefSeq, Jul 2008]'
• Locus ID: 1610