D Amino Acid Oxidase (DAO) (NM_001917) Human 3' UTR Clone

CAT#: SC205786

3`UTR clone of D-amino-acid oxidase (DAO) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DAO
Synonyms DAAO; DAMOX; OXDA
ACCN NM_001917
Insert Size 413 bp
Sequence Data
>SC205786 3'UTR clone of NM_001917
The sequence shown below is from the reference sequence of NM_001917. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTCCAGAATGCCACCATCCCACCTCTGAAGACTCCAGTGACTGCTGCCTCCCCCCACAAGAACTCCCTTC
TCCCCTCAGCCAATGAATCAATGTGCTCCTTCATAAGCCATTGCTTCTCCCTCACTTCTTTCCTCAAAGA
AGCATGAGGTGAGAGAAAGCCACAAAGTCAGTGCCTGGAGAAGGGTTCAGCCCAACATGGGGCCCCTCTC
ATCACTGAAATCCCTCTACCTTCTCTGGGTCTGGCATTATAAAGAACAGCTGAGGCTGTCATTCCATGAG
TCTTCAGAAGAAAGGACAGCTCAGAAAATCAAAGAGGCCAACTGCCCAGAGCCACAGAAAATGGAGGATA
ATTGAGGCTAAGTAACCTGATTACAAGTTGTACTAACATATTAAAGGTTCTGAAAAGTCCTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001917.4
Summary 'This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia. [provided by RefSeq, Jul 2008]'
Locus ID 1610

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.