HSD11B1 (NM_181755) Human 3' UTR Clone

CAT#: SC205790

3`UTR clone of hydroxysteroid (11-beta) dehydrogenase 1 (HSD11B1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSD11B1
• Synonyms: 11-beta-HSD1; 11-DH; CORTRD2; HDL; HSD11; HSD11B; HSD11L; SDR26C1
• ACCN: NM_181755
• Insert Size: 429 bp
• Sequence Data:
  Insert Sequence

  >SC205790 3'UTR clone of NM_181755
  The sequence shown below is from the reference sequence of NM_181755. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACAGATTCATAAACAAGTAGGAACTCCCTGAGGGCTGGGCATGCTGAGGGATTTTGGGACTGTTCTGTC
  TCATGTTTATCTGAGCTCTTATCTATGAAGACATCTTCCCAGAGTGTCCCCAGAGACATGCAAGTCATGG
  GTCACACCTGACAAATGGAAGGAGTTCCTCTAACATTTGCAAAATGGAAATGTAATAATAATGAATGTCA
  TGCACCGCTGCAGCCAGCAGTTGTAAAATTGTTAGTAAACATAGGTATAATTACCAGATAGTTATATTAA
  ATTTATATCTTATATATAATAATATGTGATGATTAATACAATATTAATTATAATAAAGGTCACATAAACT
  TTATAAATTCATAACTGGTAGCTATAACTTGAGCTTATTCAGGATGGTTTCTTTAAAACCATAAACTGTA
  CAAATGAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_181755.1
• Summary: 'The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]'
• Locus ID: 3290