POLR3K (NM_016310) Human 3' UTR Clone

CAT#: SC205794

3`UTR clone of polymerase (RNA) III (DNA directed) polypeptide K 12.3 kDa (POLR3K) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: POLR3K
• Synonyms: C11; C11-RNP3; My010; RPC10; RPC11; RPC12.5
• ACCN: NM_016310
• Insert Size: 464
• Sequence Data:
  Insert Sequence

  >SC205794 3'UTR clone of NM_016310
  The sequence shown below is from the reference sequence of NM_016310. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAATGCTCAGTGTGGACACCGCTGGAGGGATTAGGGCCAGGATGGCCCAGCTGCCCTAGTGTGTGCTTG
  CCTTGTCCCTCGGGGTAGATGCTTAGCTGGCAGTATGAGTTGTGTGTCCTGAGGGTCTTTGCTAGTGTGG
  TGGAAAGATAAACCTTTTGAGGTGAAGAGCCAGGGGGTCAGGAAATATGGCCTATCTGCCAGGCAGGGTG
  GATGAAGTCATGAATGTCTGGGAGTTTTTCTGTGTGGGGAGGAGACAGAGACCCATAACTAAATATGCTC
  TGTGTAAAGTCCTATTCTTTCATCTTCCACTTTATTGGCAGTTGACATTCCCTTACTCCCAATCAACACT
  CTTAAATATTTGTACTGTTTGTAAAACTTAGTACATGTCCCTAAATATTTAACTGTTACTTGTAAACTTG
  TGTAATTTATTATTTATTTTAATCAAAATTCTGAATATTTCATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016310.2
• Summary: This gene encodes a small essential subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The carboxy-terminal domain of this subunit shares a high degree of sequence similarity to the carboxy-terminal domain of an RNA polymerase II elongation factor. This similarity in sequence is supported by functional studies showing that this subunit is required for proper pausing and termination during transcription. Pseudogenes of this gene are found on chromosomes 13 and 17. [provided by RefSeq, Jul 2010]
• Locus ID: 51728