Laminin 5 (LAMB3) (NM_000228) Human 3' UTR Clone

CAT#: SC205798

3`UTR clone of laminin beta 3 (LAMB3) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LAMB3
• Synonyms: AI1A; BM600-125KDA; LAM5; LAMNB1
• ACCN: NM_000228
• Insert Size: 419 bp
• Sequence Data:
  Insert Sequence

  >SC205798 3'UTR clone of NM_000228
  The sequence shown below is from the reference sequence of NM_000228. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGCTCTACTATGCCACCTGCAAGTGATGCTACAGCTTCCAGCCCGTTGCCCCACTCATCTGCCGCCTTT
  GCTTTTGGTTGGGGGCAGATTGGGTTGGAATGCTTTCCATCTCCAGGAGACTTTCATGCAGCCTAAAGTA
  CAGCCTGGACCACCCCTGGTGTGTAGCTAGTAAGATTACCCTGAGCTGCAGCTGAGCCTGAGCCAATGGG
  ACAGTTACACTTGACAGACAAAGATGGTGGAGATTGGCATGCCATTGAAACTAAGAGCTCTCAAGTCAAG
  GAAGCTGGGCTGGGCAGTATCCCCCGCCTTTAGTTCTCCACTGGGGAGGAATCCTGGACCAAGCACAAAA
  ACTTAACAAAAGTGATGTAAAAATGAAAAGCCAAATAAAAATCTTTGGAAAAGAGCCTGGAGGTTCAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000228.2
• Summary: 'The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 3914