TFIIE beta (GTF2E2) (NM_002095) Human 3' UTR Clone

CAT#: SC205819

3`UTR clone of general transcription factor IIE polypeptide 2 beta 34kDa (GTF2E2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GTF2E2
• Synonyms: FE; TF2E2; TFIIE-B; TTD6
• ACCN: NM_002095
• Insert Size: 450 bp
• Sequence Data:
  Insert Sequence

  >SC205819 3'UTR clone of NM_002095
  The sequence shown below is from the reference sequence of NM_002095. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGGAGTGCTGAAGGATTACTCTGACATTACTTCCAGCAAATAGGGAACAGTTTTGCCCTGGAACAGAGT
  TACAGATACACAATCAAGAGTGTTCTTGCTGATGCTCGGGGTCTGAAGACTGTCTTCCTATCTGCTTCTT
  GCGGCTGAGGAGAGGAGCAGTTCAGTTTACAAAACAAGTGCAAATTACCAAACTCAAAGCTTATTTGAGT
  AGAATGGGCTCATGGGCAATGTGATGTTCCCTGTTAACCTTCTGTTACTCCCTGGGAGAAAGGCGCTGAG
  CGTGGCATGCAGGTGTCTTTGCTGTGTTTTTCTCCACTTCTAAATGGTTCCTGGTTCCTTTCTTCCTCGT
  TTGTTACTTTAGAGCAAGTTTGCCCATAGTCTTGAATGCAATATTTGTTTATTCCAAAAGAACATATTTA
  TAATAAAATCACTGTAGAAGGATTTTTAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002095.4
• Summary: 'The general transcription factor IIE (TFIIE) is part of the RNA polymerase II transcription initiation complex, recruiting TFIIH and being essential for promoter clearance by RNA polymerase II. TFIIE is a heterodimer (and sometimes heterotetramer) of alpha and beta subunits. The protein encoded by this gene represents the beta subunit of TFIIE. [provided by RefSeq, Jan 2017]'
• Locus ID: 2961